ID: 1067749348_1067749356

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1067749348 1067749356
Species Human (GRCh38) Human (GRCh38)
Location 10:48959888-48959910 10:48959930-48959952
Sequence CCAAGTGGAGGGCCAGTGACCAG GGAAAACCCAGAGAAGGGATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 22, 4: 165} {0: 1, 1: 0, 2: 1, 3: 33, 4: 495}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!