ID: 1067841334_1067841340

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1067841334 1067841340
Species Human (GRCh38) Human (GRCh38)
Location 10:49681829-49681851 10:49681861-49681883
Sequence CCTCATTTAACCTTAATTACCTC CTGTAGTCACATTGGGAGTTAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 13, 3: 105, 4: 435}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!