ID: 1068662303_1068662308

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1068662303 1068662308
Species Human (GRCh38) Human (GRCh38)
Location 10:59635259-59635281 10:59635292-59635314
Sequence CCAAGAACAATAGGACTGAGCTA CTGGACTCAGTGGGAACAACAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!