ID: 1068775474_1068775478

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1068775474 1068775478
Species Human (GRCh38) Human (GRCh38)
Location 10:60863839-60863861 10:60863864-60863886
Sequence CCTTTTAAACTTGTCTGGGTGCC TTCCCAGCTTCTGTGTTCTTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 31, 4: 357}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!