ID: 1068824154_1068824157

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1068824154 1068824157
Species Human (GRCh38) Human (GRCh38)
Location 10:61414434-61414456 10:61414466-61414488
Sequence CCAAAAGAAATGAGGTGATTGTA TTTAAATGCTTCAAGTGTAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 347} {0: 1, 1: 0, 2: 0, 3: 20, 4: 214}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!