ID: 1068860807_1068860811

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1068860807 1068860811
Species Human (GRCh38) Human (GRCh38)
Location 10:61846044-61846066 10:61846081-61846103
Sequence CCGAGAAGTATAGGAATGTTGTT CTGTAGGCCAACACCAGCACAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!