ID: 1069350601_1069350604

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1069350601 1069350604
Species Human (GRCh38) Human (GRCh38)
Location 10:67521720-67521742 10:67521759-67521781
Sequence CCTGTATCTGCTCTAACCATTAG GACCCACCTGCACCTCTGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 98} {0: 1, 1: 0, 2: 0, 3: 15, 4: 151}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!