ID: 1069419153_1069419160

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1069419153 1069419160
Species Human (GRCh38) Human (GRCh38)
Location 10:68231196-68231218 10:68231212-68231234
Sequence CCACCCCCGCGGAGGCGCGCGCC GCGCGCCCTAGGTGGCCATCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 271} {0: 1, 1: 0, 2: 0, 3: 1, 4: 37}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!