ID: 1069548227_1069548233

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1069548227 1069548233
Species Human (GRCh38) Human (GRCh38)
Location 10:69343956-69343978 10:69344001-69344023
Sequence CCAACATTCGTAAGGTCCATTCC ACCCAGAGATTGAACCCTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 78} {0: 1, 1: 0, 2: 0, 3: 16, 4: 144}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!