ID: 1069586108_1069586110

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1069586108 1069586110
Species Human (GRCh38) Human (GRCh38)
Location 10:69603683-69603705 10:69603728-69603750
Sequence CCAGTACTATCTTATCTGAACTA GTTGCAAATAAACCACAAGCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!