ID: 1069679084_1069679086

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1069679084 1069679086
Species Human (GRCh38) Human (GRCh38)
Location 10:70270896-70270918 10:70270909-70270931
Sequence CCAAGAGAGATCAGGGTGTATAG GGGTGTATAGTTCTCAAAGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 7, 4: 88}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!