ID: 1069739574_1069739582

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1069739574 1069739582
Species Human (GRCh38) Human (GRCh38)
Location 10:70678955-70678977 10:70678979-70679001
Sequence CCACCCACTGTTATGGAGGGCCT CTGGGTGTCCTAGCTGTGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 276} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!