ID: 1069757466_1069757473

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1069757466 1069757473
Species Human (GRCh38) Human (GRCh38)
Location 10:70782001-70782023 10:70782027-70782049
Sequence CCTGACTTCTTCTCCAGTTTCAG AGCCTTTGGACTGAAGGAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 304} {0: 1, 1: 0, 2: 1, 3: 25, 4: 252}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!