ID: 1069761173_1069761186

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1069761173 1069761186
Species Human (GRCh38) Human (GRCh38)
Location 10:70812630-70812652 10:70812677-70812699
Sequence CCCTTGCTCACTCCAGTTGGCAA TGGGGGCTCCCATGTCTGTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 150} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!