ID: 1069772966_1069772974

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1069772966 1069772974
Species Human (GRCh38) Human (GRCh38)
Location 10:70911082-70911104 10:70911120-70911142
Sequence CCCTTCAGGAGAAGCTACCCCAA ATCCCAGCTGCCGCACCTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 225} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!