ID: 1069780356_1069780364

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1069780356 1069780364
Species Human (GRCh38) Human (GRCh38)
Location 10:70951552-70951574 10:70951573-70951595
Sequence CCCTCTGCCCTCCATAAATAAGG GGAGCTTCCATCTATTGGGCCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 4, 4: 109}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!