ID: 1069877026_1069877030

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1069877026 1069877030
Species Human (GRCh38) Human (GRCh38)
Location 10:71569196-71569218 10:71569213-71569235
Sequence CCTTCCTCTCCCTTGCAGCACCC GCACCCACTCCCATCCCTAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 56, 4: 551} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!