ID: 1069898214_1069898222

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1069898214 1069898222
Species Human (GRCh38) Human (GRCh38)
Location 10:71691975-71691997 10:71691999-71692021
Sequence CCCAGCTCTCAGGAGCTTCCCCC CAGTGAGCCCTCATTCCCAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 281} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!