ID: 1069906018_1069906023

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1069906018 1069906023
Species Human (GRCh38) Human (GRCh38)
Location 10:71732657-71732679 10:71732705-71732727
Sequence CCGAGATCAATATCCCTGTAACA GATAAAGTTTATACCTATGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 137} {0: 1, 1: 0, 2: 1, 3: 7, 4: 88}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!