ID: 1070112055_1070112075

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1070112055 1070112075
Species Human (GRCh38) Human (GRCh38)
Location 10:73495871-73495893 10:73495912-73495934
Sequence CCGGCTCCGGGGCGGCCATGCTG GCTCTGGGCCGGGCGGGGTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 166} {0: 1, 1: 0, 2: 2, 3: 31, 4: 361}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!