ID: 1070112067_1070112075

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1070112067 1070112075
Species Human (GRCh38) Human (GRCh38)
Location 10:73495897-73495919 10:73495912-73495934
Sequence CCGGGGCTCGGCTAGGCTCTGGG GCTCTGGGCCGGGCGGGGTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 33, 4: 293} {0: 1, 1: 0, 2: 2, 3: 31, 4: 361}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!