ID: 1070112328_1070112332

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1070112328 1070112332
Species Human (GRCh38) Human (GRCh38)
Location 10:73497697-73497719 10:73497713-73497735
Sequence CCTGACTCCATCTGTTCAAAAGG CAAAAGGGTGAATGTTATGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 252} {0: 1, 1: 0, 2: 1, 3: 6, 4: 157}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!