ID: 1070162566_1070162585

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1070162566 1070162585
Species Human (GRCh38) Human (GRCh38)
Location 10:73874677-73874699 10:73874717-73874739
Sequence CCCGCCCCCGGGGAGGGGCCTCC CGCCCCGGAGCCGCCCTCGCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 10, 3: 44, 4: 436} {0: 1, 1: 0, 2: 3, 3: 19, 4: 262}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!