ID: 1070312566_1070312579

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1070312566 1070312579
Species Human (GRCh38) Human (GRCh38)
Location 10:75284307-75284329 10:75284353-75284375
Sequence CCATAACAAACCAGCCTAAGAGA CAGAAGAGGGAGCAGCAGGCGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!