ID: 1070479701_1070479710

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1070479701 1070479710
Species Human (GRCh38) Human (GRCh38)
Location 10:76870235-76870257 10:76870255-76870277
Sequence CCTTCCCACGCTGACCCTGAGTC GTCCCATGGGAGGGAAGCACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 282} {0: 1, 1: 0, 2: 0, 3: 23, 4: 275}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!