ID: 1070624114_1070624118

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1070624114 1070624118
Species Human (GRCh38) Human (GRCh38)
Location 10:78036954-78036976 10:78036982-78037004
Sequence CCAAACTCCCTGTTGAGAGAATG TGGACCATTTGTTTCCTGTGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 40, 4: 221}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!