ID: 1071251945_1071251949 |
View in Genome Browser |
Spacer: 1 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1071251945 | 1071251949 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 10:83827555-83827577 | 10:83827579-83827601 |
| Sequence | CCAATGGTTTGCCAAGGGCTCTC | GGCCTTCGGCCACAGAGTGAAGG |
| Strand | - | + |
| Off-target summary | {0: 1, 1: 14, 2: 227, 3: 456, 4: 549} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||