ID: 1071433549_1071433557

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1071433549 1071433557
Species Human (GRCh38) Human (GRCh38)
Location 10:85625643-85625665 10:85625680-85625702
Sequence CCTTCTCAGTCTACCTGCTCCCT GGAAAAAAATTGACATGGTGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 6, 3: 37, 4: 570}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!