ID: 1071527419_1071527434

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1071527419 1071527434
Species Human (GRCh38) Human (GRCh38)
Location 10:86366525-86366547 10:86366563-86366585
Sequence CCGCGCGCCCGCCCCTGCGCCCT CAGCCCAGCCCAGCCCAGCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 110, 4: 854} {0: 3, 1: 11, 2: 36, 3: 148, 4: 797}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!