ID: 1071562728_1071562739

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1071562728 1071562739
Species Human (GRCh38) Human (GRCh38)
Location 10:86656216-86656238 10:86656248-86656270
Sequence CCCACTATACCCTGGGCACAGTG GTGGGACTCACGGGGATGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 290} {0: 1, 1: 0, 2: 0, 3: 10, 4: 132}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!