ID: 1071570240_1071570246

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1071570240 1071570246
Species Human (GRCh38) Human (GRCh38)
Location 10:86692692-86692714 10:86692735-86692757
Sequence CCTGCAAAGGGCTCCAGCTGACA GAGTCAGTGAGGTGGGCACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 211} {0: 1, 1: 0, 2: 0, 3: 28, 4: 282}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!