ID: 1071613991_1071613996

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1071613991 1071613996
Species Human (GRCh38) Human (GRCh38)
Location 10:87057690-87057712 10:87057707-87057729
Sequence CCGATATCCTGTCTTGGAACTCT AACTCTGCCGTGGGTACAATGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 22, 4: 207} {0: 2, 1: 0, 2: 0, 3: 1, 4: 65}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!