ID: 1071632410_1071632413

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1071632410 1071632413
Species Human (GRCh38) Human (GRCh38)
Location 10:87228372-87228394 10:87228387-87228409
Sequence CCTTGTGACTGCAGGGGCTCCTC GGCTCCTCCAGGCGGCCCTCTGG
Strand - +
Off-target summary {0: 4, 1: 1, 2: 0, 3: 26, 4: 196} {0: 4, 1: 2, 2: 4, 3: 30, 4: 306}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!