ID: 1071835721_1071835731

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1071835721 1071835731
Species Human (GRCh38) Human (GRCh38)
Location 10:89415175-89415197 10:89415215-89415237
Sequence CCACCCATCGCGACCCGACGGCT CGGTGACCGTGCTGGGTCCGCGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 1, 3: 10, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!