ID: 1071857972_1071857983

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1071857972 1071857983
Species Human (GRCh38) Human (GRCh38)
Location 10:89645068-89645090 10:89645090-89645112
Sequence CCTCCTCTGCGCCCTGCCCCCCG GCGCGCCGGCCCCACGGCGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 103, 4: 830} {0: 1, 1: 0, 2: 1, 3: 11, 4: 209}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!