ID: 1072147506_1072147511

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1072147506 1072147511
Species Human (GRCh38) Human (GRCh38)
Location 10:92655466-92655488 10:92655500-92655522
Sequence CCCAAAATAAACTATGCAGGTAC AAGGAGCCTAGTAAACTTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 189} {0: 1, 1: 0, 2: 1, 3: 5, 4: 140}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!