ID: 1072253783_1072253789

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1072253783 1072253789
Species Human (GRCh38) Human (GRCh38)
Location 10:93601403-93601425 10:93601421-93601443
Sequence CCTCCAGGACAGCCTCGGGCACA GCACAGTGGAGCGGCCGCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 50, 4: 230} {0: 1, 1: 0, 2: 1, 3: 5, 4: 132}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!