ID: 1072472432_1072472439 |
View in Genome Browser |
Spacer: 13 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1072472432 | 1072472439 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 10:95724693-95724715 | 10:95724729-95724751 |
Sequence | CCAGAGGGGTGGAAGTCAGTGAT | TGGCAAACAGCAGTGGTGGATGG |
Strand | - | + |
Off-target summary | {0: 3, 1: 9, 2: 37, 3: 111, 4: 264} | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |