ID: 1072570130_1072570135

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1072570130 1072570135
Species Human (GRCh38) Human (GRCh38)
Location 10:96651298-96651320 10:96651327-96651349
Sequence CCGCTTGCAGGGATATTGTTCTT TTCGGTTAGCAGTTTATCAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 148} {0: 1, 1: 0, 2: 0, 3: 1, 4: 90}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!