ID: 1072591712_1072591728

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1072591712 1072591728
Species Human (GRCh38) Human (GRCh38)
Location 10:96833023-96833045 10:96833070-96833092
Sequence CCGAGCCAAGTGGGGTGTCATGG CCTCAGCGGGCGGCGGTGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 110} {0: 1, 1: 0, 2: 2, 3: 23, 4: 292}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!