ID: 1072608154_1072608157

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1072608154 1072608157
Species Human (GRCh38) Human (GRCh38)
Location 10:97000586-97000608 10:97000603-97000625
Sequence CCTACCACCAGCAGATTCTGTAG CTGTAGCAGCAGAATGAACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 170} {0: 1, 1: 0, 2: 3, 3: 27, 4: 260}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!