ID: 1072638881_1072638891

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1072638881 1072638891
Species Human (GRCh38) Human (GRCh38)
Location 10:97196231-97196253 10:97196244-97196266
Sequence CCAGCCCCGGCCCGCGGCGTCGG GCGGCGTCGGGGCAGCGGCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 418} {0: 1, 1: 0, 2: 1, 3: 62, 4: 667}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!