ID: 1072690973_1072690976

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1072690973 1072690976
Species Human (GRCh38) Human (GRCh38)
Location 10:97572272-97572294 10:97572295-97572317
Sequence CCTGGCCTGGACAAGTAGAGTGT GACCCTCCTCACAGCCAGCAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 30, 4: 356}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!