ID: 1072705149_1072705153

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1072705149 1072705153
Species Human (GRCh38) Human (GRCh38)
Location 10:97675669-97675691 10:97675693-97675715
Sequence CCACATTGTCTTGATCCAGACCA CTCTGTGATCAGAAGGAAATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 21, 3: 1244, 4: 28380} {0: 1, 1: 1, 2: 3, 3: 26, 4: 285}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!