ID: 1072710780_1072710792

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1072710780 1072710792
Species Human (GRCh38) Human (GRCh38)
Location 10:97714422-97714444 10:97714469-97714491
Sequence CCGATCGGGGCGGGGGAATCCCC CCCCCGCCGCCGCCCCGCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 39} {0: 1, 1: 2, 2: 26, 3: 168, 4: 970}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!