ID: 1072718562_1072718574

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1072718562 1072718574
Species Human (GRCh38) Human (GRCh38)
Location 10:97767228-97767250 10:97767260-97767282
Sequence CCCTCCACCTTTCCCTTACCCTC GCCTACTTTCTGAGACCCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 138, 4: 1460} {0: 1, 1: 0, 2: 1, 3: 11, 4: 151}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!