ID: 1072733991_1072733997

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1072733991 1072733997
Species Human (GRCh38) Human (GRCh38)
Location 10:97866980-97867002 10:97867019-97867041
Sequence CCTCCCCTAGGGCTACCAGGGAA TGTTCTAGTGGAAGAGAAGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 124} {0: 1, 1: 0, 2: 3, 3: 18, 4: 213}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!