ID: 1072898540_1072898544

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1072898540 1072898544
Species Human (GRCh38) Human (GRCh38)
Location 10:99387896-99387918 10:99387915-99387937
Sequence CCTTCACAGACGGGGACTCCACT CACTAAGGCCCCCACAACCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 113} {0: 1, 1: 0, 2: 2, 3: 16, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!