ID: 1073097103_1073097111

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1073097103 1073097111
Species Human (GRCh38) Human (GRCh38)
Location 10:100986686-100986708 10:100986704-100986726
Sequence CCGGAGTAACAGTCCAAAGCCTG GCCTGGGGCTGCAGTTGGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 234} {0: 1, 1: 0, 2: 3, 3: 51, 4: 496}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!