ID: 1073287293_1073287297

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1073287293 1073287297
Species Human (GRCh38) Human (GRCh38)
Location 10:102396579-102396601 10:102396616-102396638
Sequence CCGAAGGAGGCCACAGGGGATTG CTGATCAGAGTGCTGTAGTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 151} {0: 1, 1: 0, 2: 3, 3: 22, 4: 395}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!